| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.164269 |
| Chromosome: | chromosome 14 |
| Location: | 2537236 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625450 | VTE3 | MPBQ/MSBQ methyltransferase, chloroplastic; (1 of 1) 2.1.1.295 - 2-methyl-6-phytyl-1,4-hydroquinone methyltransferase / MPBQ/MSBQ methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATGTACACTCCCATCATCCCTCTCCGCA |
| Internal bar code: | GGGATGGCCGAGATGAGACAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 149 |
| LEAP-Seq percent confirming: | 50.8772 |
| LEAP-Seq n confirming: | 435 |
| LEAP-Seq n nonconfirming: | 420 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACCAAAACGAAGCCAATG |
| Suggested primer 2: | TTTGGTTTAGTTTGGGCTGG |