| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.164332 |
| Chromosome: | chromosome 12 |
| Location: | 5997415 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g534945 | (1 of 2) K18740 - exonuclease 3'-5' domain-containing protein 1 (EXD1, EGL) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTGGTGCAGACGCAGGCTTGCGCAGTTG |
| Internal bar code: | TAGTGGCTTTTATTCTGGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1023 |
| LEAP-Seq percent confirming: | 99.449 |
| LEAP-Seq n confirming: | 1444 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTTTCTGGTTCAGTCACG |
| Suggested primer 2: | TCACATCACGGGTCCTTACA |