Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.164358 |
Chromosome: | chromosome 16 |
Location: | 7353830 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684715 | DCL2 | Dicer-like protein; (1 of 4) 3.1.26.3 - Ribonuclease III / RNase III | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTACAATGCACAACTTCAACGACTTCGG |
Internal bar code: | GCTGATCTCCTGTTGTACATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 347 |
LEAP-Seq percent confirming: | 98.3183 |
LEAP-Seq n confirming: | 7191 |
LEAP-Seq n nonconfirming: | 123 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATCAGACCAACAGCAGCA |
Suggested primer 2: | TGCATTCGGAGTGCTCTATG |