Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.164362 |
Chromosome: | chromosome 3 |
Location: | 3029612 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g164050 | KIN15-1,KIN15A,KIN12-1 | Kinesin motor protein; (1 of 2) K10400 - kinesin family member 15 (KIF15) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAAGGACGCCCTGCAGCAGCAGCGGCAC |
Internal bar code: | GTACCGGCTACTGCACTTGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1199 |
LEAP-Seq percent confirming: | 99.2593 |
LEAP-Seq n confirming: | 2412 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCCAAGAACCCAAGTGTTA |
Suggested primer 2: | ACACCACTTGAGGACCCTTG |