| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.164406 |
| Chromosome: | chromosome 2 |
| Location: | 7144735 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g146600 | AP4M4 | Mu4-Adaptin; (1 of 1) K12402 - AP-4 complex subunit mu-1 (AP4M1) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TACATCGCCAGCTTCCAAATTGACAAGGTC |
| Internal bar code: | CAGCTAGTTTCACGTTGTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 553 |
| LEAP-Seq percent confirming: | 99.2136 |
| LEAP-Seq n confirming: | 757 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGAGCCAGAGGTCGTGTC |
| Suggested primer 2: | GCAGCTCGTAGATGAGGACC |