Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.164409 |
Chromosome: | chromosome 12 |
Location: | 2396119 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g507250 | (1 of 1) K18681 - DIS3-like exonuclease 1 (DIS3L) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGAGGCGTGTGGTTGACGGACGCGTGAT |
Internal bar code: | CGCAATGGCCGGCCCGGCATGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 641 |
LEAP-Seq percent confirming: | 96.3041 |
LEAP-Seq n confirming: | 10449 |
LEAP-Seq n nonconfirming: | 401 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCTACAGCCTCCCAAGTG |
Suggested primer 2: | GCACATACCGTGCATACCAG |