| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.164484 |
| Chromosome: | chromosome 10 |
| Location: | 3644995 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445650 | SMC3 | (1 of 1) K06669 - structural maintenance of chromosome 3 (chondroitin sulfate proteoglycan 6) (SMC3, CSPG6); Structural Maintenance of Chromosomes protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGGTGTAAGTGTGGGTTGGGAACAACG |
| Internal bar code: | GCCTATTGCTAAACCCACATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 517 |
| LEAP-Seq percent confirming: | 99.7382 |
| LEAP-Seq n confirming: | 762 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACATGTTTGGGAGGTGCAA |
| Suggested primer 2: | ACCCTAGAGCGCACAAGAAA |