Insertion junction: LMJ.RY0402.164686_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.164686
Chromosome:chromosome_8
Location:4151435
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCTTGGCGGCGGCGGGACAGGCGGCGGGA
Internal bar code:GCACTTGATCTTTCCTGTAAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:549
LEAP-Seq percent confirming:40.3509
LEAP-Seq n confirming:46
LEAP-Seq n nonconfirming:68
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC