| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.164698 |
| Chromosome: | chromosome 6 |
| Location: | 6641485 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294000 | CGL113 | Dienelactone hydrolase family protein; (1 of 2) K01061 - carboxymethylenebutenolidase (E3.1.1.45) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTGGCGTAAATACGGTAAATGTGATGAG |
| Internal bar code: | GAGTGACGTACCTCCAAGGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 375 |
| LEAP-Seq percent confirming: | 98.9362 |
| LEAP-Seq n confirming: | 93 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACCCCTTCCCGTTTAGGA |
| Suggested primer 2: | GTTACCTGCCACAAGCCATT |