| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.164801 |
| Chromosome: | chromosome 7 |
| Location: | 3800758 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g338500 | (1 of 102) PF01753 - MYND finger (zf-MYND) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAAGCTGATTAGCAGCGACGCCCGCCGA |
| Internal bar code: | ACATACGTGTTTTTGCTGGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 99.5895 |
| LEAP-Seq n confirming: | 1213 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGAACGCATGTATGGAGGG |
| Suggested primer 2: | GTTGACCCACATCAATGCAG |