| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.164927 |
| Chromosome: | chromosome 7 |
| Location: | 1623769 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325101 | (1 of 2) PTHR30336 - INNER MEMBRANE PROTEIN, PROBABLE PERMEASE | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTTCGCCTGCAGTTCAACGGAACCTAGC |
| Internal bar code: | AACGATGAGAAGCGTGGCGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 225 |
| LEAP-Seq percent confirming: | 99.646 |
| LEAP-Seq n confirming: | 563 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTTGCATGACACGCTCTT |
| Suggested primer 2: | ATGCGTGTCAAAGGTCATCA |