| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.164938 |
| Chromosome: | chromosome 1 |
| Location: | 2541987 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g014650 | PHX2,P4H5,PFH5 | Prolyl 4-hydroxylase 5; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAAGTTCCATAACTTGTGCGGATATCGTC |
| Internal bar code: | GCGTCATCGCCGACGAATTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 98.8625 |
| LEAP-Seq n confirming: | 2868 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCTAGAACAGGCACCAG |
| Suggested primer 2: | AATGACACACAACAACCCGA |