Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.165056 |
Chromosome: | chromosome 12 |
Location: | 2545257 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g505800 | MSC6,MSCL2,CAM16 | (1 of 2) IPR002048//IPR006685//IPR010920 - EF-hand domain // Mechanosensitive ion channel MscS // LSM domain; Predicted protein with mechanosensitive ion channel domain | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCCGCCGCGAGCAATCGTGGTTTTGTG |
Internal bar code: | GCAATCCGGTATCAATTTGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 670 |
LEAP-Seq percent confirming: | 99.4916 |
LEAP-Seq n confirming: | 1957 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCACTTTGACTGGGCATT |
Suggested primer 2: | CAACATTCTGGCTCCCAAGT |