| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.165100 |
| Chromosome: | chromosome 1 |
| Location: | 6217831 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044450 | (1 of 15) PF01694 - Rhomboid family (Rhomboid) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATTGCCCCTTCACGGCCCCGCCTTTTCCT |
| Internal bar code: | CGACTCAGGCACACTGCGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 340 |
| LEAP-Seq percent confirming: | 99.4675 |
| LEAP-Seq n confirming: | 8592 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTAAATGTGATGGCACGC |
| Suggested primer 2: | CTACAGGAGCACATGGCTGA |