Insertion junction: LMJ.RY0402.165113_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.165113
Chromosome:chromosome_6
Location:1882293
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g263200 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CGACCTACCCACGGGCTTCTAGACGCGACC
Internal bar code:CTACTTAGGGAAGTGCGAATGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:155
LEAP-Seq percent confirming:99.6705
LEAP-Seq n confirming:1815
LEAP-Seq n nonconfirming:6
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:CGTGGGATATACAACCAGGG
Suggested primer 2:AGGTCGTATACCACGCAAGG