| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.165255 |
| Chromosome: | chromosome 2 |
| Location: | 5816863 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111000 | RRA1,CGL9 | (1 of 3) PTHR10994//PTHR10994:SF3 - RETICULON // ARABINOSYLTRANSFERASE; Reduced residual arabinose 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGCCAAGTAATTCGCATTTTCTTGTG |
| Internal bar code: | CCCCAGTAACCTTAGGTCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 441 |
| LEAP-Seq percent confirming: | 99.6198 |
| LEAP-Seq n confirming: | 1048 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACGTCGATCGTCAGCTCTT |
| Suggested primer 2: | GTGGAGCAGAGTGCATGAAA |