| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.165389 |
| Chromosome: | chromosome 2 |
| Location: | 5522553 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108400 | DAD1 | Putative defender against death (DAD) protein; (1 of 1) K12668 - oligosaccharyltransferase complex subunit epsilon (OST2, DAD1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAACCAGCGGCACCGCTGCTCTTCCCC |
| Internal bar code: | CCGTACCTCCGGTTTCACAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 856 |
| LEAP-Seq percent confirming: | 94.0862 |
| LEAP-Seq n confirming: | 2466 |
| LEAP-Seq n nonconfirming: | 155 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGTGTTTTACCGCATT |
| Suggested primer 2: | GGTACAGGTTCTGGATGCGT |