| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.165615 |
| Chromosome: | chromosome 6 |
| Location: | 8879916 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310950 | FAO7 | (1 of 1) 1.5.8.3 - Sarcosine dehydrogenase; FAD-dependent oxidoreductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCATACGATACAAGGGTTGTTAAGTCG |
| Internal bar code: | GGAGTCTTTGATACCGTGCGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 598 |
| LEAP-Seq percent confirming: | 98.8372 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATGCCCCTACTTACCTT |
| Suggested primer 2: | TGTTTGCTGTCTGCTTACGG |