Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.165722 |
Chromosome: | chromosome 16 |
Location: | 7719260 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g691440 | FAP43 | Flagellar Associated Protein 43; (1 of 2) PTHR14885//PTHR14885:SF1 - UNCHARACTERIZED // WD REPEAT-CONTAINING PROTEIN 96 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACTGTGACACCGAGACGCTGCACTCGCT |
Internal bar code: | AGAGGCCACGAAGCGGGCTCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 603 |
LEAP-Seq percent confirming: | 96.2575 |
LEAP-Seq n confirming: | 1929 |
LEAP-Seq n nonconfirming: | 75 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGAAGGTCCAAGGCTGTT |
Suggested primer 2: | TAAGCCGAATCACTCCATCC |