Insertion junction: LMJ.RY0402.165722_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.165722
Chromosome:chromosome_16
Location:7719260
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g691440 FAP43 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TAACTGTGACACCGAGACGCTGCACTCGCT
Internal bar code:AGAGGCCACGAAGCGGGCTCGG

Confirmation - LEAP-Seq

LEAP-Seq distance:603
LEAP-Seq percent confirming:96.2575
LEAP-Seq n confirming:1929
LEAP-Seq n nonconfirming:75
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:AAGGAAGGTCCAAGGCTGTT
Suggested primer 2:TAAGCCGAATCACTCCATCC