| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.165889 |
| Chromosome: | chromosome 1 |
| Location: | 3762572 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024251 | (1 of 1) PF00270//PF00271//PF04408 - DEAD/DEAH box helicase (DEAD) // Helicase conserved C-terminal domain (Helicase_C) // Helicase associated domain (HA2) (HA2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGCACGCGTGCGCGTCAGCTGCTGCGTA |
| Internal bar code: | CCCTATTCGTAACATGGATTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 865 |
| LEAP-Seq percent confirming: | 99.5314 |
| LEAP-Seq n confirming: | 2761 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGGATTTGTGACACTGTTG |
| Suggested primer 2: | CGAAGCATGATGTCTGCACT |