Insertion junction: LMJ.RY0402.165898_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.165898
Chromosome:chromosome_2
Location:5087917
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g104900 FAP204 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TTTGGCCGGGAATTTTGCGGCGCACATGTG
Internal bar code:TATAGTGAACTTGGGGTTTGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:441
LEAP-Seq percent confirming:99.7072
LEAP-Seq n confirming:4427
LEAP-Seq n nonconfirming:13
LEAP-Seq n unique pos:3

Suggested primers for confirmation by PCR

Suggested primer 1:CTGTACCGAGACATCGCTGA
Suggested primer 2:ATTCATCAACGCAACTTCCC