Insertion junction: LMJ.RY0402.165898_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.165898
Chromosome:chromosome_2
Location:5087918
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g104900 FAP204 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CCCAACACTAACGGCGCCCACACCGCGCAA
Internal bar code:TCCAGGCTATTTCTCGTGTAGC

Confirmation - LEAP-Seq

LEAP-Seq distance:0
LEAP-Seq percent confirming:0.0
LEAP-Seq n confirming:0
LEAP-Seq n nonconfirming:16
LEAP-Seq n unique pos:0

Suggested primers for confirmation by PCR

Suggested primer 1:ATTCATCAACGCAACTTCCC
Suggested primer 2:CTGTACCGAGACATCGCTGA