| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.165993 |
| Chromosome: | chromosome 12 |
| Location: | 1292890 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g489000 | (1 of 10) PF00170 - bZIP transcription factor (bZIP_1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGCTGCTAGGATACTCGCCTCTTGATGG |
| Internal bar code: | AGAATTGGTCCTCCGGCCGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1154 |
| LEAP-Seq percent confirming: | 99.7205 |
| LEAP-Seq n confirming: | 6422 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTTACGGCGGCCAATTA |
| Suggested primer 2: | GATGTAGGTTCGGCGTGAAT |