| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.166034 |
| Chromosome: | chromosome 12 |
| Location: | 401661 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g494000 | CGL82 | (1 of 2) IPR002083//IPR008974 - MATH/TRAF domain // TRAF-like; Conserved, expressed protein with meprin and TRAF homology domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGAGCAGGCGGGCTCGGACGGCAGCAGC |
| Internal bar code: | GTTTTCGACAAGGGGGAGGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 94.1667 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGAAGGAGGCGGAAAAG |
| Suggested primer 2: | CTGCAGGCAGAAAGGACTTC |