| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.166036 |
| Chromosome: | chromosome 6 |
| Location: | 1163274 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g257250 | BBS2 | Bardet-Biedl syndrome-2 associated protein; (1 of 1) K16747 - Bardet-Biedl syndrome 2 protein (BBS2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGAATGCGCACGGTGTCGAAGAGGGTG |
| Internal bar code: | GCAGTGAGGTGAACTGAGCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 509 |
| LEAP-Seq percent confirming: | 99.763 |
| LEAP-Seq n confirming: | 9682 |
| LEAP-Seq n nonconfirming: | 23 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATAGAGCTGCCCAAGTTCG |
| Suggested primer 2: | TGGGGGCAGTGAAGAATAAG |