| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.166215 |
| Chromosome: | chromosome 16 |
| Location: | 513528 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692902 | AHI1 | Abelson-helper integration site 1; (1 of 3) PTHR22847:SF361 - JOUBERIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCTCAGTCCAACCACTCCACACCTTCGC |
| Internal bar code: | CTCCGACCGTTACTCTCCATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 409 |
| LEAP-Seq percent confirming: | 6.77966 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 55 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAAGTACAAGCGGGGTGAG |
| Suggested primer 2: | GGATGTTTGGAAAAGCGGTA |