| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.166295 |
| Chromosome: | chromosome 1 |
| Location: | 263772 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g001657 | DAB1,DNAAF3,PF22 | Dynein Assembly factor PF22; (1 of 1) PTHR22118//PTHR22118:SF14 - FAMILY NOT NAMED // DYNEIN ASSEMBLY FACTOR 3, AXONEMAL | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAACTGAAGAGTGACGACAGAAGAAAAGC |
| Internal bar code: | AGCAGATAGCTCATACGCTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 952 |
| LEAP-Seq percent confirming: | 99.8159 |
| LEAP-Seq n confirming: | 3796 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTGGGGGAGTGTGTTAG |
| Suggested primer 2: | GAGCAGCTGTAAGGGAGGG |