Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.166364 |
Chromosome: | chromosome 9 |
Location: | 3484450 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g389578 | PSBP5 | PsbP-like protein of thylakoid lumen; (1 of 1) PTHR31407//PTHR31407:SF16 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 7, CHLOROPLASTIC | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTTGTCCCTGTTACTGGCTCTAATAAC |
Internal bar code: | GTTTGCCAACCGATACGGCCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1226 |
LEAP-Seq percent confirming: | 98.2055 |
LEAP-Seq n confirming: | 5363 |
LEAP-Seq n nonconfirming: | 98 |
LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCATGACACCTCCACATACG |
Suggested primer 2: | GCCCTTATTTTTGCACCTCA |