Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.166389 |
Chromosome: | chromosome 1 |
Location: | 8022002 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g071662 | ACS1 | Acetyl-CoA synthetase/ligase; (1 of 3) K01895 - acetyl-CoA synthetase (ACSS, acs) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCGCGCAACTGTGCCGCCTAACCCGC |
Internal bar code: | CATCACACCCAATCAGCCATCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 564 |
LEAP-Seq percent confirming: | 78.8054 |
LEAP-Seq n confirming: | 18498 |
LEAP-Seq n nonconfirming: | 4975 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGACTACGTCGTGTGCAGC |
Suggested primer 2: | GCCTTGACTGTTTCAGGAGC |