| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.166477 |
| Chromosome: | chromosome 16 |
| Location: | 2047570 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657100 | (1 of 781) IPR000104 - Antifreeze protein, type I | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGAGACAGACCCGGCTGCCGCAGTGGCG |
| Internal bar code: | CCTCCTGCATCGACGTAGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 332 |
| LEAP-Seq percent confirming: | 99.7108 |
| LEAP-Seq n confirming: | 4138 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTACACCGCTCGAATCCAAT |
| Suggested primer 2: | TAGGGGCCATACGTTACAGC |