| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.166596 |
| Chromosome: | chromosome 14 |
| Location: | 3351788 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630100 | RPL13 | Ribosomal protein L13, component of cytosolic 80S ribosome and 6 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGCTGCTAGACTGGTGGAGTTGCACTTA |
| Internal bar code: | GGGTGCGTAGATCACGATTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 812 |
| LEAP-Seq percent confirming: | 98.725 |
| LEAP-Seq n confirming: | 542 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAACGCCAGTAATAGCACA |
| Suggested primer 2: | CAAGCTTCAGCAACAATGGA |