| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.166632 |
| Chromosome: | chromosome 12 |
| Location: | 8451047 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g548300 | TMEM107 | (1 of 1) PF14995 - Transmembrane protein (TMEM107); Transmembrane protein 107 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTAGACCACTATGATTCGACCAAGTCGCA |
| Internal bar code: | GGCTAGTGCATGGTAGCTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 99.622 |
| LEAP-Seq n confirming: | 1845 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTTTCGCTCACTCCACA |
| Suggested primer 2: | CGAAGGAGTCGAAGTTCCAG |