| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.166656 |
| Chromosome: | chromosome 13 |
| Location: | 471182 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g564900 | MRP3 | (1 of 18) 3.6.3.44 - Xenobiotic-transporting ATPase / Steroid-transporting ATPase; ABC transporter, multidrug resistance associated protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGGCTTCTTGCCTTTTCATCCGCTGTTC |
| Internal bar code: | TGGGACATTGTAAATCGCTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 807 |
| LEAP-Seq percent confirming: | 86.1111 |
| LEAP-Seq n confirming: | 930 |
| LEAP-Seq n nonconfirming: | 150 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTAGCAAGAAGGGACAAG |
| Suggested primer 2: | TTTCGTGCTTGTCTGAAACG |