| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.166760 |
| Chromosome: | chromosome 13 |
| Location: | 3342415 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g586700 | FXL2 | FixL-like PAS domain protein; (1 of 12) 2.7.13.3 - Histidine kinase / Protein kinase (histidine) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTAGTTCCGCCATACACAGTAATTACAC |
| Internal bar code: | GATAAAGGCGCTGGATGGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 815 |
| LEAP-Seq percent confirming: | 99.6856 |
| LEAP-Seq n confirming: | 3171 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTGTTGCTGCTGTCATGC |
| Suggested primer 2: | TCATGCTGCTGTGTTCATCA |