| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.166836 |
| Chromosome: | chromosome 9 |
| Location: | 759345 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g402350 | (1 of 6) IPR000253//IPR008984 - Forkhead-associated (FHA) domain // SMAD/FHA domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGCCTGCCCACCCCCTTCTGCACCTTG |
| Internal bar code: | GAGTCCGGCGCGTATCGGCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 988 |
| LEAP-Seq percent confirming: | 99.4482 |
| LEAP-Seq n confirming: | 5947 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTATGTTACTGCCGGTCT |
| Suggested primer 2: | AGTGCGGGATCCACGTATAG |