| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.166841 |
| Chromosome: | chromosome 17 |
| Location: | 1371150 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g706200 | (1 of 1) IPR006029//IPR006201 - Neurotransmitter-gated ion-channel transmembrane domain // Neurotransmitter-gated ion-channel | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACTGTGACTGTGAAACACTGCCCGGGTG |
| Internal bar code: | AGTGATCTGTGAACGTTAAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1011 |
| LEAP-Seq percent confirming: | 98.1871 |
| LEAP-Seq n confirming: | 3033 |
| LEAP-Seq n nonconfirming: | 56 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTTGAAGTGCATTCAGGT |
| Suggested primer 2: | GAGCCTTTCCACACCACATT |