| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.166915 |
| Chromosome: | chromosome 11 |
| Location: | 1186183 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467690 | GST8B | (1 of 15) 2.5.1.18 - Glutathione transferase / S-(hydroxyalkyl)glutathione lyase; putative Glutathione S-transferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGACCAGCCGTGTCCTCTGATGCTGCAG |
| Internal bar code: | AGGTGGCTGTGGGGTGACCTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1094 |
| LEAP-Seq percent confirming: | 99.7238 |
| LEAP-Seq n confirming: | 4693 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTCAGCTTCATAGCCACC |
| Suggested primer 2: | GCAAGGTGCATAACACGAGA |