Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.166953 |
Chromosome: | chromosome 2 |
Location: | 1092781 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g081100 | (1 of 2) PF02893 - GRAM domain (GRAM) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCGCATTGGCTCGCCGGAGTCTACGGC |
Internal bar code: | ACACACGGCAACAGCAAAGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 724 |
LEAP-Seq percent confirming: | 99.2797 |
LEAP-Seq n confirming: | 2481 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAGGTAACGACTCACCCG |
Suggested primer 2: | CTTCAAGGACTTCGAGTCGG |