| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.166992 |
| Chromosome: | chromosome 14 |
| Location: | 3451099 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g630750 | MAPKKK10 | (1 of 8) IPR000719//IPR001245//IPR011009 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Protein kinase-like domain; Mitogen-Activated Protein Kinase Kinase Kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACCAGGCCTCGCAGGGTGAGAGGCGCGG |
| Internal bar code: | AGTGTCCGCAAGGGCCCTCATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 66 |
| LEAP-Seq percent confirming: | 93.4211 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCAGATCCTCATCACCAG |
| Suggested primer 2: | ACCTGTGAGTGTGTGTGGGA |