Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.166997 |
Chromosome: | chromosome 4 |
Location: | 2653849 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g223000 | HLM9 | Histone-lysine N-methyltransferase; (1 of 1) PF12234 - RAVE protein 1 C terminal (Rav1p_C) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTCACAACCCCAATGTCTGCGCCACA |
Internal bar code: | GCCTGGTTCGGGGATACGTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 302 |
LEAP-Seq percent confirming: | 98.3094 |
LEAP-Seq n confirming: | 1163 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGACCTGAGCAGAGGAAGTG |
Suggested primer 2: | CCTCGCCTGACTGAATCCTA |