| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167038 |
| Chromosome: | chromosome 10 |
| Location: | 1613151 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g429600 | (1 of 1) PTHR22883:SF59 - PROTEIN S-ACYLTRANSFERASE 22-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGAACTACTCCGGCGGTGGCAAGGCAAC |
| Internal bar code: | GAAGCGGGGCACCCTATGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1076 |
| LEAP-Seq percent confirming: | 99.6371 |
| LEAP-Seq n confirming: | 21692 |
| LEAP-Seq n nonconfirming: | 79 |
| LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGCAGAACTTTACGTCGC |
| Suggested primer 2: | AGTCGTCGGTGGTGTAGGTC |