| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.167078 |
| Chromosome: | chromosome 3 |
| Location: | 5739023 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188200 | RNPH2,RPH2 | 3'-5' Exoribonuclease PH component of the Exosome; (1 of 1) PTHR11097:SF8 - EXOSOME COMPLEX COMPONENT RRP42 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAGACCTGCAAGGGGTCTCCCCCTTGC |
| Internal bar code: | ACCGGCGTACCCTCCCGACGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | |
| LEAP-Seq percent confirming: | |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTAACACCCCTCATCTCGT |
| Suggested primer 2: | AAACCAACACCCAGAACCAG |