| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167281 |
| Chromosome: | chromosome_6 |
| Location: | 8748380 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre06.g309900 | MST2 | Predicted protein with sequence similarity to mastigoneme protei | antisense | CDS |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GGCACGAATATGGTGGTGCGGTTCTCGACG |
| Internal bar code: | GCGTCGGGAAGCGTGAACGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 141 |
| LEAP-Seq percent confirming: | 73.031 |
| LEAP-Seq n confirming: | 306 |
| LEAP-Seq n nonconfirming: | 113 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCACAAACCTGAACCTAA |
| Suggested primer 2: | ACACACAGGTACCAGCCCTC |