Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.167350 |
Chromosome: | chromosome 2 |
Location: | 8407006 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g141606 | DHC9 | (1 of 1) IPR004273//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - Dynein heavy chain domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase; Axonemal inner arm dynein heavy chain, dynein c (monomeric) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTACATGGGCAGACGTACAGTACGACATT |
Internal bar code: | GAGGAGGGTCGACCAAGCCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 755 |
LEAP-Seq percent confirming: | 99.6933 |
LEAP-Seq n confirming: | 1950 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTCTGGTCTGGACTGGTGT |
Suggested primer 2: | GAGTCTTCTACGACCGCCTG |