| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167351 |
| Chromosome: | chromosome 2 |
| Location: | 1705584 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086050 | PUS4 | (1 of 1) 4.2.1.70//5.4.99.12//5.4.99.45 - Pseudouridylate synthase / Uracil hydrolyase // tRNA pseudouridine(38-40) synthase / tRNA pseudouridylate synthase I // tRNA pseudouridine(38/39) synthase / Pseudouridine synthase 3; RNA pseudouridine synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCAGGCGAGGTGGAGCCAGTGGCAGGGGA |
| Internal bar code: | GACACGGAGACAGACGCGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 546 |
| LEAP-Seq percent confirming: | 98.2456 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTGGGTAGGCAGGACAGT |
| Suggested primer 2: | TCAATGACACCCACGACTGT |