Insertion junction: LMJ.RY0402.167379_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.167379
Chromosome:chromosome_9
Location:655489
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre09.g403200 FAP198 Flagellar Associated Protein sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GCGATGGATCCAGGCGGTCTATGGTAAATG
Internal bar code:CAGGGAGCGGACGCGGGGGGTC

Confirmation - LEAP-Seq

LEAP-Seq distance:885
LEAP-Seq percent confirming:99.7838
LEAP-Seq n confirming:1846
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:16

Suggested primers for confirmation by PCR

Suggested primer 1:TTATTTAAAGCACGTCCGGG
Suggested primer 2:CCATGTGTCTTGTACGTGGC