| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.167388 |
| Chromosome: | chromosome 9 |
| Location: | 7351452 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g413100 | (1 of 16) IPR005069//IPR029044 - Nucleotide-diphospho-sugar transferase // Nucleotide-diphospho-sugar transferases | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTGTGCAGGGTTGTTCCCATGTACACCA |
| Internal bar code: | GTAGGCGCATGAATCTGGGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 914 |
| LEAP-Seq percent confirming: | 99.7519 |
| LEAP-Seq n confirming: | 804 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGTAGTCCCGCAAAGCA |
| Suggested primer 2: | GCCGTAGCACTCACAGATCA |