| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.167428 |
| Chromosome: | chromosome 6 |
| Location: | 5336895 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g283400 | SPH2,CGL101 | (1 of 4) 3.1.3.24 - Sucrose-phosphate phosphatase / Sucrose-6-phosphate phosphatase; sucrose-phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGAGACCAACGGGCGCACCGCCGCCTCC |
| Internal bar code: | TTGAGGTGGCGTGGGTCTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 749 |
| LEAP-Seq percent confirming: | 99.5905 |
| LEAP-Seq n confirming: | 9484 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGGGGAAAGCCGTATATT |
| Suggested primer 2: | TACTATCGTGCGCTGAGTGG |