| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167467 |
| Chromosome: | chromosome 2 |
| Location: | 5789563 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g110750 | LHCB7,LHCQ | Light-harvesting chlorophyll a-b binding protein, chloroplast precursor; (1 of 1) K14172 - light-harvesting complex II chlorophyll a/b binding protein 7 (LHCB7) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAAGTATGGTTATTGTTCATTTATGCA |
| Internal bar code: | ATATACGCGTGCAGTGAATCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 957 |
| LEAP-Seq percent confirming: | 98.7597 |
| LEAP-Seq n confirming: | 3185 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTGTAAGGATGGGCTGGT |
| Suggested primer 2: | GTACATGCCAGTGCCTGATG |