| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.167704 |
| Chromosome: | chromosome 13 |
| Location: | 4580429 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g603900 | TSF1 | (1 of 1) K01890 - phenylalanyl-tRNA synthetase beta chain (FARSB, pheT); Phenylalanyl-tRNA synthetase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCACTCACCCCTCCCCCTCCCCCTCCC |
| Internal bar code: | CCAGCCGCATCCCCCACTTCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 61 |
| LEAP-Seq percent confirming: | 88.2979 |
| LEAP-Seq n confirming: | 83 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTCCTCGCTCTATTGCAT |
| Suggested primer 2: | CCAAGATCCAGGTGTGTGTG |